ID: 1005866644_1005866654

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1005866644 1005866654
Species Human (GRCh38) Human (GRCh38)
Location 6:29942618-29942640 6:29942653-29942675
Sequence CCTGGGCGGGTGAGTGCGGGGTC GCCTCTGCGGGGAGAAGCAAGGG
Strand - +
Off-target summary {0: 4, 1: 4, 2: 1, 3: 15, 4: 162} {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!