ID: 1005912987_1005913001

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1005912987 1005913001
Species Human (GRCh38) Human (GRCh38)
Location 6:30326976-30326998 6:30327023-30327045
Sequence CCGGACCCGAAGCCGGGAAGGTA AGCCTGGGGCCTGCGCTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38} {0: 1, 1: 0, 2: 0, 3: 12, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!