ID: 1005989935_1005989943

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1005989935 1005989943
Species Human (GRCh38) Human (GRCh38)
Location 6:30896519-30896541 6:30896535-30896557
Sequence CCGGGAGACACAGGGCCCTCCGG CCTCCGGGAGGCTGAGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 243} {0: 1, 1: 0, 2: 5, 3: 92, 4: 1127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!