ID: 1006092686_1006092692

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1006092686 1006092692
Species Human (GRCh38) Human (GRCh38)
Location 6:31637271-31637293 6:31637303-31637325
Sequence CCTTCCACCTACAGTGGAGTCTT GCGCGTCGACCTTTACCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 221} {0: 1, 1: 2, 2: 1, 3: 0, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!