ID: 1006093340_1006093346

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1006093340 1006093346
Species Human (GRCh38) Human (GRCh38)
Location 6:31641133-31641155 6:31641146-31641168
Sequence CCATCTGCTGTCCCCCCAAGCAG CCCCAAGCAGTGCAGGTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 250} {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!