ID: 1006093396_1006093402

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1006093396 1006093402
Species Human (GRCh38) Human (GRCh38)
Location 6:31641416-31641438 6:31641460-31641482
Sequence CCAAGGACTGAGAGACAAGATAA AATCATAAGACTGGGAGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 300} {0: 1, 1: 1, 2: 7, 3: 83, 4: 826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!