ID: 1006096965_1006096972

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1006096965 1006096972
Species Human (GRCh38) Human (GRCh38)
Location 6:31662151-31662173 6:31662183-31662205
Sequence CCAAAAACTTCAGGATCTGCATC CCCAGGAAGGGGAAGTCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 222} {0: 1, 1: 0, 2: 0, 3: 34, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!