ID: 1006119344_1006119353

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1006119344 1006119353
Species Human (GRCh38) Human (GRCh38)
Location 6:31794954-31794976 6:31794969-31794991
Sequence CCCTGGGCCCCCCAGGCCTGCTG GCCTGCTGGCCACAGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 599} {0: 1, 1: 0, 2: 0, 3: 29, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!