ID: 1006132056_1006132060

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006132056 1006132060
Species Human (GRCh38) Human (GRCh38)
Location 6:31875639-31875661 6:31875675-31875697
Sequence CCATTTCTGGGGGGACTCAAGAA CAATGGTTCTTAACGTGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 126} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!