ID: 1006148371_1006148380

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1006148371 1006148380
Species Human (GRCh38) Human (GRCh38)
Location 6:31972438-31972460 6:31972468-31972490
Sequence CCCGGAGACCTTTGGAGTTAAGA GAAGCGAGGGCCTGTGGAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130} {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!