ID: 1006151103_1006151110

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006151103 1006151110
Species Human (GRCh38) Human (GRCh38)
Location 6:31990486-31990508 6:31990514-31990536
Sequence CCCACGTTGGGCGCCAGAATGTT CCAGCCTCAACACCACCTGTAGG
Strand - +
Off-target summary No data {0: 8, 1: 20, 2: 22, 3: 34, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!