ID: 1006151475_1006151480

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1006151475 1006151480
Species Human (GRCh38) Human (GRCh38)
Location 6:31992382-31992404 6:31992406-31992428
Sequence CCAGCTGGAGCTCAGCGTGGACG TGCCAAGCAGTACCGGAACGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 690} {0: 2, 1: 0, 2: 0, 3: 0, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!