ID: 1006157776_1006157781

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1006157776 1006157781
Species Human (GRCh38) Human (GRCh38)
Location 6:32025120-32025142 6:32025144-32025166
Sequence CCAGCTGGAGCTCAGCGTGGACG TGCCAAGCAGTACCGGAACGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 27, 4: 690} {0: 2, 1: 0, 2: 0, 3: 0, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!