ID: 1006313274_1006313280

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1006313274 1006313280
Species Human (GRCh38) Human (GRCh38)
Location 6:33276400-33276422 6:33276424-33276446
Sequence CCGAGGCCAGCACACCAAGACCA TGGCCGCCGTGGCCGCACCGTGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 5, 3: 23, 4: 406} {0: 2, 1: 0, 2: 1, 3: 13, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!