ID: 1006316267_1006316272

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1006316267 1006316272
Species Human (GRCh38) Human (GRCh38)
Location 6:33293641-33293663 6:33293666-33293688
Sequence CCCGTGGGGCAGGAGGGTCACTG ACCAGGTGGCTCCACCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 243} {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!