ID: 1006332848_1006332855

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006332848 1006332855
Species Human (GRCh38) Human (GRCh38)
Location 6:33404786-33404808 6:33404835-33404857
Sequence CCACAGTTTGTTCTTCTTCTTGG TGTTCTCTTCTGGGCAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 455} {0: 1, 1: 0, 2: 19, 3: 318, 4: 745}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!