ID: 1006358193_1006358205

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006358193 1006358205
Species Human (GRCh38) Human (GRCh38)
Location 6:33572984-33573006 6:33573037-33573059
Sequence CCCCCAGGGATGGGGGTGAGAGC GTGTCTATAAGGAGAGAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 40, 4: 383} {0: 2, 1: 1, 2: 1, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!