ID: 1006367074_1006367086

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006367074 1006367086
Species Human (GRCh38) Human (GRCh38)
Location 6:33621975-33621997 6:33622006-33622028
Sequence CCTTTGCAGGTGGTCCCGGGGGC GGGTGGCTGGAGGCTGAGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 88, 4: 731}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!