ID: 1006369162_1006369174

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006369162 1006369174
Species Human (GRCh38) Human (GRCh38)
Location 6:33633683-33633705 6:33633734-33633756
Sequence CCTTGGCGGCGGCGGCGCGTCGT TTTCGCTTCGCCGCGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!