ID: 1006378734_1006378745

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006378734 1006378745
Species Human (GRCh38) Human (GRCh38)
Location 6:33685637-33685659 6:33685688-33685710
Sequence CCACAGGCCGCGTGGCCTCCTTC CGCTGGGCCCCAGCCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194} {0: 1, 1: 0, 2: 2, 3: 44, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!