ID: 1006379773_1006379779

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006379773 1006379779
Species Human (GRCh38) Human (GRCh38)
Location 6:33690789-33690811 6:33690817-33690839
Sequence CCTCCCTGGAGGAGCCTTGGGAA CTGGAGCCCAGGCAGCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 263} {0: 1, 1: 0, 2: 1, 3: 71, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!