ID: 1006385966_1006385978

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006385966 1006385978
Species Human (GRCh38) Human (GRCh38)
Location 6:33731135-33731157 6:33731166-33731188
Sequence CCAGCAGCCTCGTGCAGTTCCTG CGAGGCCTCCTAGCTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 219} {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!