ID: 1006395091_1006395098

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006395091 1006395098
Species Human (GRCh38) Human (GRCh38)
Location 6:33782063-33782085 6:33782091-33782113
Sequence CCCTAACACAGCCAGATCCTCCT AAAGTTGATCTTGACCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 220} {0: 1, 1: 0, 2: 2, 3: 5, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!