ID: 1006416865_1006416872

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1006416865 1006416872
Species Human (GRCh38) Human (GRCh38)
Location 6:33909657-33909679 6:33909702-33909724
Sequence CCTCGGCGTGTCATCCACATGAG AGAAGGACATTTCATCCCGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!