ID: 1006430578_1006430584

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006430578 1006430584
Species Human (GRCh38) Human (GRCh38)
Location 6:33993296-33993318 6:33993324-33993346
Sequence CCAGTGGAGACAGGAACTGCGTT CTGAGTGAGTGGGAAGTGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!