ID: 1006436497_1006436513

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1006436497 1006436513
Species Human (GRCh38) Human (GRCh38)
Location 6:34028405-34028427 6:34028450-34028472
Sequence CCGACTGAGGGCCCTGACTCCCG CCCGGCATCCCGCTGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160} {0: 1, 1: 0, 2: 2, 3: 9, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!