ID: 1006439364_1006439375

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006439364 1006439375
Species Human (GRCh38) Human (GRCh38)
Location 6:34043590-34043612 6:34043632-34043654
Sequence CCAAGGACGCACCCAGCCATGGG GGAAACACACCTCCCCCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!