ID: 1006556725_1006556735

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006556725 1006556735
Species Human (GRCh38) Human (GRCh38)
Location 6:34873268-34873290 6:34873321-34873343
Sequence CCTGTTGTCCGCCTGGAGTCCTG TTCTGTCTCCCTGGGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137} {0: 1, 1: 2, 2: 104, 3: 384, 4: 990}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!