ID: 1006574131_1006574137

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006574131 1006574137
Species Human (GRCh38) Human (GRCh38)
Location 6:35031530-35031552 6:35031544-35031566
Sequence CCTTCCTCCTCCTCCCCATTTTG CCCATTTTGTGCCAGTCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 18, 3: 175, 4: 1618} {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!