ID: 1006574340_1006574342

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1006574340 1006574342
Species Human (GRCh38) Human (GRCh38)
Location 6:35033272-35033294 6:35033313-35033335
Sequence CCACAGGTCTCCAGAAGGACTTG GAACTAAGCAAATCCTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!