ID: 1006578665_1006578674

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1006578665 1006578674
Species Human (GRCh38) Human (GRCh38)
Location 6:35064061-35064083 6:35064099-35064121
Sequence CCTGACCAGGCGGGAGAGATGGC GGCTCTCGAAAGCCACGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!