ID: 1006582683_1006582694

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1006582683 1006582694
Species Human (GRCh38) Human (GRCh38)
Location 6:35085970-35085992 6:35085995-35086017
Sequence CCCTGGCCCCAGGGATTCAAGGG CAGGGTGGTCAGCGTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 400} {0: 1, 1: 0, 2: 3, 3: 20, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!