ID: 1006605068_1006605075

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006605068 1006605075
Species Human (GRCh38) Human (GRCh38)
Location 6:35250234-35250256 6:35250285-35250307
Sequence CCATGGAGTCAGTGTGGACCTCA GTGATTCTCTACCCCAAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 221} {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!