ID: 1006638551_1006638555

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006638551 1006638555
Species Human (GRCh38) Human (GRCh38)
Location 6:35476761-35476783 6:35476796-35476818
Sequence CCATAGAGATGTGTGTAAATGTA GTGTGCTTGTAGCTGTGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 673} {0: 1, 1: 0, 2: 1, 3: 15, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!