ID: 1006679691_1006679703

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006679691 1006679703
Species Human (GRCh38) Human (GRCh38)
Location 6:35788062-35788084 6:35788098-35788120
Sequence CCAGAGCTCTGTGTTCACCCTGT CACCATGAGTGGAGGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 269} {0: 1, 1: 0, 2: 2, 3: 24, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!