ID: 1006719154_1006719157

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1006719154 1006719157
Species Human (GRCh38) Human (GRCh38)
Location 6:36138872-36138894 6:36138895-36138917
Sequence CCTGCAGCTGCGGACCTGCTGGA GAAGATGCTGGAGCTAGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 446} {0: 1, 1: 0, 2: 1, 3: 12, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!