ID: 1006755983_1006755985

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1006755983 1006755985
Species Human (GRCh38) Human (GRCh38)
Location 6:36415945-36415967 6:36415961-36415983
Sequence CCTGAAGACATCAATTTTGTATA TTGTATATGAAACAGGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!