ID: 1006790375_1006790382

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1006790375 1006790382
Species Human (GRCh38) Human (GRCh38)
Location 6:36697501-36697523 6:36697535-36697557
Sequence CCCATCAACCTGCTGCTGTCTGG GCCTTGGCAACCAGAGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!