ID: 1006803024_1006803030

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1006803024 1006803030
Species Human (GRCh38) Human (GRCh38)
Location 6:36771479-36771501 6:36771509-36771531
Sequence CCTATACATAAAGCACTTAGAGC GGCCCATGGTTAAGTGCTATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 117} {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!