ID: 1006831407_1006831414

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1006831407 1006831414
Species Human (GRCh38) Human (GRCh38)
Location 6:36970422-36970444 6:36970467-36970489
Sequence CCATGAGGTCGCCAACTAGCAGG CTGCAATCTGAAACCCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 47} {0: 1, 1: 0, 2: 2, 3: 27, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!