ID: 1006841252_1006841257

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1006841252 1006841257
Species Human (GRCh38) Human (GRCh38)
Location 6:37029214-37029236 6:37029258-37029280
Sequence CCGGTGAACTAAGGTCAAAGCTC ATAAGACAAGCAGAGAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104} {0: 1, 1: 0, 2: 2, 3: 50, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!