ID: 1006979529_1006979537

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1006979529 1006979537
Species Human (GRCh38) Human (GRCh38)
Location 6:38135865-38135887 6:38135894-38135916
Sequence CCTTGAGCCTGCAGTCCAGAAGG TCTCTGTGGAGCAGGTATTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!