ID: 1007096305_1007096313

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1007096305 1007096313
Species Human (GRCh38) Human (GRCh38)
Location 6:39215311-39215333 6:39215336-39215358
Sequence CCTTCCACTCGCTGCTCTGAAGG GCAGGGATGCTGAGAAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!