ID: 1007109758_1007109769

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1007109758 1007109769
Species Human (GRCh38) Human (GRCh38)
Location 6:39306289-39306311 6:39306330-39306352
Sequence CCGCCTTGGCCTACCAAAGTGCT CACCGCACCCGGCCTGGGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 40, 3: 209, 4: 855}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!