ID: 1007133212_1007133215

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1007133212 1007133215
Species Human (GRCh38) Human (GRCh38)
Location 6:39496216-39496238 6:39496247-39496269
Sequence CCCTCAGATTTCACTGTCACATC TTTGCCACATGACCACAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 270} {0: 1, 1: 0, 2: 1, 3: 29, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!