ID: 1007175825_1007175833

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1007175825 1007175833
Species Human (GRCh38) Human (GRCh38)
Location 6:39896786-39896808 6:39896810-39896832
Sequence CCTCTGACCTGTGCCTCCTCTCC AGCCATCCTGTTGGCCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 94, 4: 913} {0: 1, 1: 0, 2: 1, 3: 23, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!