ID: 1007250442_1007250449

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1007250442 1007250449
Species Human (GRCh38) Human (GRCh38)
Location 6:40491447-40491469 6:40491462-40491484
Sequence CCCCACTCCATTTTGCTGTGTGA CTGTGTGACTGTGGGTAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 6, 3: 23, 4: 316} {0: 3, 1: 6, 2: 4, 3: 61, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!