ID: 1007251417_1007251433

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1007251417 1007251433
Species Human (GRCh38) Human (GRCh38)
Location 6:40497733-40497755 6:40497780-40497802
Sequence CCAACTCCCCCACCCTCACCTTC GGCCTTTGCAGAGAGGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 208, 4: 1958} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!