ID: 1007251419_1007251432

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1007251419 1007251432
Species Human (GRCh38) Human (GRCh38)
Location 6:40497740-40497762 6:40497774-40497796
Sequence CCCCACCCTCACCTTCCTGTCTT ATGCATGGCCTTTGCAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 882} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!