ID: 1007251423_1007251436

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1007251423 1007251436
Species Human (GRCh38) Human (GRCh38)
Location 6:40497746-40497768 6:40497790-40497812
Sequence CCTCACCTTCCTGTCTTCCCCAG GAGAGGGCCTTGGGCTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 141, 4: 1437} {0: 1, 1: 0, 2: 3, 3: 29, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!